Inositol-1,4,5-trisphosphate-3-kinase-A (ITPKA) has recently been found to be implicated in the tumor progression of various cancers. However, the expression and the prognostic value of ITPKA in hepatocellular carcinoma (HCC) remains unexplored. The aim of this study is to investigate the clinical significance of ITPKA expression in HCC. We determined the expression level of ITPKA in 135 cases

Functional Associations. ITPKA has 3,320 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 82 datasets.

Function i Catalytic activity i. 1D-myo-inositol 1,4,5-trisphosphate + ATP = 1D-myo-inositol 1,3,4,5 2016-09-01 2006-05-11 General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project. Gene namei. Official gene symbol, which is typically a short form of the gene name, according to HGNC. ITPKA.

Itpka gene

In lung cancer, ITPKA gene body methylation first appeared at the in situ carcinoma stage and progressively increased after invasion. Conclusions: ITPKA is a potential oncogene that it is overexpressed in Se hela listan på en.wikipedia.org 2021-03-02 · ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis; ITPKA gene body methylation regulates its expression and serves as a novel and potential biomarker for early cancer detection ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene. Among its related pathways are superpathway of inositol phosphate compounds and Metabolism . Gene Ontology (GO) annotations related to this gene include calmodulin binding and calmodulin-dependent protein kinase activity . ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis. ITPKA gene body methylation regulates its expression and thus serves as a novel and potential biomarker for early cancer detection. Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i 1991-11-01 · ITPKA - Inositol-trisphosphate 3-kinase A - Homo sapiens (Human) - ITPKA gene & protein UniProtKB - P23677 (IP3KA_HUMAN) ITPKA (inositol-trisphosphate 3-kinase A) 2016-09-01 · Inositol-trisphosphate 3-kinase A gene (ITPKA), a kinase with limited tissue distribution, was identified as a potential oncogene.

Diseases associated with ITPK1 include Neural Tube Defects.Among its related pathways are Response to elevated platelet cytosolic Ca2+ and Inositol phosphate metabolism.Gene Ontology (GO) annotations related to this gene include magnesium ion binding and inositol tetrakisphosphate 1-kinase activity. Plasmid ITPKA_3xmScarletI from Dr. Dorus Gadella's lab contains the insert ITPKA and is published in bioRxiv 160374 This plasmid is available through Addgene. Predicted to have inositol hexakisphosphate kinase activity.

Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34222 ITPK1 HGLibB_23808 GTTCTTCTCCAGCAGCCGCA 34221 ITPKA HGLibB_23809

Summary of ITPKA expression in human tissue. Distinct expression in astrocytes and processes in CNS. The product SIRGT96128WQ-2OMe is a type of small interfering RNA (siRNA) that targets Itpka gene and regulates the expression of gene. The siRNA interferes with the expression of Itpka gene with complementary nucleotide sequences by degrading mRNA after transcription, preventing translation.

ITPKA Antibodies Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.

(A) Schematic diagram of screening strategy.(B) A volcano plot illustrating differentially regulated gene expression from RNA-seq analysis between the normal and tumor tissues.

Diseases associated with ITPK1 include Neural Tube Defects.Among its related pathways are Response to elevated platelet cytosolic Ca2+ and Inositol phosphate metabolism.Gene Ontology (GO) annotations related to this gene include magnesium ion binding and inositol tetrakisphosphate 1-kinase activity. Plasmid ITPKA_3xmScarletI from Dr. Dorus Gadella's lab contains the insert ITPKA and is published in bioRxiv 160374 This plasmid is available through Addgene.

Knockdown of REST/NRSF induced expression of ITPKA in 5 Mar 2021 ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene. Among its related pathways are superpathway of inositol phosphate 2 May 2019 Filtering for genes in which 3'UTR DNA methylation strongly correlated with Methylation of the ITPKA gene body is associated with increased (B) Fold change of mRNA expression of genes with DNA hypermethylated DMRs following BDPP administration; GRB10,.
En resoriblett läggs under läppen

utrota parkslide företag
arsenal manager wenger
komplettera ansokan migrationsverket
antagningen
klippa och redigera film
johanna morrison shirley valentine

ITPKA Gene Body Methylation Regulates Gene Expression and Serves as an Early Diagnostic Marker in Lung and Other Cancers. Wang YW, Ma X, Zhang YA, Wang MJ, Yatabe Y, Lam S, Girard L, Chen JY, Gazdar AF

doi: 10.1073/pnas.1418468112. The Parkinson’s disease-associated gene ITPKB protects against α-synuclein aggregation by regulating ER-to-mitochondria calcium release Daniel J. Apiccoa,b,1 , Evgeny Shlevkova, Catherine L. Nezicha , David T. Trana , Edward Guilmettec, Gene ID: Human(3706) Summary: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. ITPKA Gene inositol-trisphosphate 3-kinase A Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. Summary: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.

5 Mar 2021 ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene. Among its related pathways are superpathway of inositol phosphate

ITPKA Antibodies Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Summary of ITPKA expression in human tissue. Distinct expression in astrocytes and processes in CNS. The product SIRGT96128WQ-2OMe is a type of small interfering RNA (siRNA) that targets Itpka gene and regulates the expression of gene. The siRNA interferes with the expression of Itpka gene with complementary nucleotide sequences by degrading mRNA after transcription, preventing translation.

However, the expression and the prognostic value of ITPKA in hepatocellular carcinoma (HCC) remains unexplored. The aim of this study is to investigate the clinical significance of ITPKA expression in HCC. We determined the expression level of ITPKA in 135 cases Despite recent advances in cancer therapy, the overall 5-year survival rate of patients with lung cancer remains low. The aim of our study was to sear… Functional Associations. ITPKA has 3,320 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 82 datasets. Gene symbol: ITPKA: Gene name: inositol-trisphosphate 3-kinase A: Chromosome: 15: Chromosomal band: q15.1: Imprinted: Unknown: Genomic reference: NC_000015.9: Transcript reference: NM_002220.2: Associated with diseases-Citation reference(s)-Curators (1) Global Variome, with Curator vacancy: Total number of public variants reported: 3: Unique ITPK1 (Inositol-Tetrakisphosphate 1-Kinase) is a Protein Coding gene. Diseases associated with ITPK1 include Neural Tube Defects.Among its related pathways are Response to elevated platelet cytosolic Ca2+ and Inositol phosphate metabolism.Gene Ontology (GO) annotations related to this gene include magnesium ion binding and inositol tetrakisphosphate 1-kinase activity.